If you have been reading about cyclic peptide and want a single page that covers the useful parts, this is it: definitions, context, how it is studied, and the questions that come up repeatedly.
Last reviewed on 2026-05-22. Where a claim depends on a specific study, the study is described rather than over-claimed.
Bremelanotide is a cyclic heptapeptide that binds several melanocortin receptors rather than one. In vitro assays report agonist activity at MC1R, MC3R, MC4R and MC5R, with MC4R generally treated as the subtype most relevant to sexual effects. MC4R is expressed in hypothalamic nuclei involved in appetite, energy balance and motivated behaviour, which provides a plausible route for central action. Selective MC4R agonists studied in animals produce comparable behavioural changes, supporting that interpretation.
How receptor activation translates into a change in desire is not established in detail. Proposed steps include modulation of dopaminergic signalling in reward circuits and downstream effects on autonomic tone. Human data consist mainly of clinical trials measuring self-reported outcomes rather than direct measurements of brain activity or transmitter release. The transient rise in blood pressure sometimes observed after administration is likewise reported consistently but explained only partly by known melanocortin pathways.
Evidence outside the studied population is sparse. Trials have concentrated on premenopausal women with a defined diagnosis, and data for postmenopausal women, men, and people taking interacting medications remain limited. Non-prescription use of the peptide for comparable goals is widespread but is not supported by published controlled data. Observed changes in blood pressure have drawn attention to cardiovascular monitoring during use. The literature generally frames the compound as a targeted receptor agonist rather than a general libido enhancer, and basic questions about mechanism and long-term safety are unresolved.
Bremelanotide functions as an agonist at several melanocortin receptor subtypes, with the strongest functional activity reported at the MC4 subtype. MC4 receptors sit in hypothalamic circuits that influence appetite, energy balance, and components of sexual behaviour. Rodents lacking functional MC4 receptors show altered mating behaviour, which supports a role for this pathway in desire. The precise sequence of events connecting receptor activation to reported human effects remains only partly characterised. Because the same receptor family governs pigmentation and inflammatory signalling, selectivity is a recurring theme in pharmacological discussion.
Clinical programmes in this area have relied mainly on randomised, double-blind, placebo-controlled designs in premenopausal women. Primary endpoints usually combine a validated questionnaire covering desire domains with counts of satisfying sexual events and a separate measure of distress. Reported outcomes show statistically significant but modest average improvement over placebo, with wide individual variation. Adverse events such as nausea, flushing, and headache occur frequently and can limit tolerability. Whether short-term trial gains translate into lasting change for most users is an open question.
| Property | Value | Notes |
|---|---|---|
| Primary receptor target | MC4R agonist | Subtype most often linked to behavioural effects |
| Other reported targets | MC1R, MC3R, MC5R | Activity is not selective for a single subtype |
| Endogenous ligand class | Melanocortin peptides | Alpha-MSH and ACTH act on the same family |
| Peptide architecture | Cyclic heptapeptide | Lactam bridge between the aspartate and lysine residues |
| Central action | Inferred from animal models | Not directly measured in the human brain |
Bremelanotide acts as an agonist at several melanocortin receptors, with the strongest reported activity at MC4R and measurable activity at MC1R and MC3R. Because MC4R is expressed in hypothalamic and limbic circuits, the proposed mechanism links receptor activation to modulation of central pathways involved in desire rather than to direct effects on peripheral genital tissue. The precise downstream steps remain incompletely characterized, and evidence for the involvement of specific neurotransmitters is suggestive rather than settled. Nausea and blood pressure elevation reported during trials are consistent with melanocortin signaling outside the intended target circuit.
Compared with melanotan II, bremelanotide is a smaller cyclic peptide with a more constrained backbone, which affects receptor selectivity and metabolic stability. Published descriptions give a plasma half-life on the order of a few hours after subcutaneous administration, with elimination through hepatic and renal routes and limited plasma protein binding. Central access is inferred from effects observed in animal models, although direct measurement in humans is limited. Handling and storage requirements follow from the peptide backbone, which is susceptible to hydrolysis and oxidation.
Clinical research typically uses randomised, double-blind, placebo-controlled designs. The most common primary endpoint is the desire domain score of the Female Sexual Function Index, sometimes paired with a distress measure. Secondary outcomes include arousal, satisfaction, and event-based counts of satisfying sexual episodes. Across trials, average improvements are modest and individual responses vary widely. Whether benefits persist beyond a few months, and whether they depend on baseline hormone status, remain open questions rather than settled findings.
Melanocortin receptors form a family of five G-protein-coupled receptors designated MC1 through MC5. Bremelanotide binds most strongly at MC4R and MC1R, with weaker activity reported at MC3R and MC5R. MC4R is expressed in hypothalamic nuclei that coordinate energy balance and aspects of sexual behaviour. The prevailing interpretation is that central MC4R activation, rather than peripheral vascular effects alone, drives the reported changes in desire. This account remains partly inferential, since direct receptor-level measurement in living humans is not practical.
=== Patent protection and litigation === The original patent, U.S. patent 4,927,855, was granted to Laboratoire L. Lafon in 1990, covering the chemical compound of modafinil. This patent expired in 2010. In 1994, Cephalon filed a patent for modafinil in the form of particles of a defined size, represented by U.S. patent 5,618,845, which expired in 2015. Following the nearing expiration of marketing rights in 2002, generic manufacturers, including Mylan and Teva, applied for US Food and Drug Administration approval to market a generic form of modafinil, leading to legal challenges by Cephalon regarding the particle size patent. The patent RE 37,516 was declared invalid and unenforceable in 2011. In addition, Cephalon entered agreements with several generic drug manufacturers to delay the sale of generic modafinil in the US. These agreements were subject to legal scrutiny and antitrust investigations, culminating in a ruling by the Court of Appeals in 2016, which found that the settlements did not violate antitrust laws.
=== 1 February === At least 60 people were killed while 250 others were injured in an RSF attack on the Sabreen Market in Omdurman. Two others were killed in an SAF airstrike in Khartoum, while at least seven were killed by RSF shelling in El Obeid. Eleven people were killed by RSF shelling on the Abu Shouk camp, while 13 others were killed during clashes in Nyala. The SAF claimed to have retaken the cities of Tambul, Rufaa and Al-Hasahisa in Gezira State.
===== Resident compensation ===== Starting from the first year of postgraduate training residents trained in the US receive compensation. According to the Medscape Residents Salary & Debt Report, in 2021 the average resident annual salary was US$64,000. In 2021, 43% of trainees polled were satisfied with their compensation according to Medcape's report.
== Pharmacology == The nonbenzodiazepines are positive allosteric modulators of the GABAA receptor. Like the benzodiazepines, they exert their effects by binding to and activating the benzodiazepine site of the receptor complex.
Pulsed electric field (PEF) electroporation is a method for processing cells by means of brief pulses of a strong electric field. PEF holds potential as a type of low-temperature alternative pasteurization process for sterilizing food products. In PEF processing, a substance is placed between two electrodes, then the pulsed electric field is applied. The electric field enlarges the pores of the cell membranes, which kills the cells and releases their contents. PEF for food processing is a developing technology still being researched. There have been limited industrial applications of PEF processing for the pasteurization of fruit juices. To date, several PEF treated juices are available on the market in Europe. Furthermore, for several years a juice pasteurization application in the US has used PEF. For cell disintegration purposes especially potato processors show great interest in PEF technology as an efficient alternative for their preheaters. Potato applications are already operational in the US and Canada. There are also commercial PEF potato applications in various countries in Europe, as well as in Australia, India, and China.
Sources: en.wikipedia.org
The water of vitriol and sulphur which is used to irrigate the drugs: yellow vitriol three parts, yellow sulphur one part, grind them and distil them in the manner of rose-water. A recipe for the preparation of sulfuric acid is mentioned in Risālat Jaʿfar al-Sādiq fī ʿilm al-ṣanʿa, an Arabic treatise falsely attributed to the Shi'i Imam Ja'far al-Sadiq (died 765). Julius Ruska dated this treatise to the 13th century, but according to Ahmad Y. al-Hassan it likely dates from an earlier period:
Clive Stace describes this as having "direct access to the genetic basis of evolution." As a simple example, prior to the use of genetic evidence, fungi were thought either to be plants or to be more closely related to plants than animals. Genetic evidence suggests that the true evolutionary relationship of multicelled organisms is as shown in the cladogram below – fungi are more closely related to animals than to plants.
This type of patients' skeletal maturation should be closely and regularly monitored. Both male and female patients who have the following medical conditions must not start a treatment with HCG Pubergen, Pregnyl: (1) Hypersensitivity to this drug or to any of its main ingredients. (2) Known or possible androgen-dependent tumors for example male breast carcinoma or prostatic carcinoma.
Bisphosphonate Bisphosphonates are either administered orally or intravenously. They reduce bone resorption. Mechanism of action: Bisphosphonate binds to the mineral component of the bone and inhibits enzymes (i.e. farnesyl-pyrophosphate synthase) responsible for bone formation, osteoclast recruitment and osteoclast function. This type of drug has a high affinity for hydroxyapatite and stays in bone tissue for a long period of time, with alendronate, it has a half-life of approximately ten years. The risk of a patient having MRONJ after discontinuing this medication is unknown. There are suggestions that bisphosphonate may inhibit the proliferation of soft tissue cells and increases apoptosis. This may result in delayed soft tissue healing. Examples of bisphosphonates: : Zoledronic acid (Reclast, Zometa), Risedronate (Actonel), Alendronate (Fosamax), Etidronate (Didronel), Ibandronate (Boniva), Pamidronate (Aredia), Tiludronate (Skelid). Denosumab Denosumab is a monoclonal antibody which is administrated subcutaneously. It inhibits osteoclast differentiation and activation, reduces bone resorption, improves bone density and lessens skeletal-related events associated with metastasis. Mechanism of action: The drug binds to receptor activator nuclear factor κB ligand (RANKL), preventing the interaction with RANK. It does not bind to bone and its effect on bone diminishes in 9 months. Osteoanabolic drugs
Sources: en.wikipedia.org
=== Unsupported health claims === In 2010 a panel of the European Food Safety Authority examined health claims made for whey protein. For the following claims either no references were provided for the claimed effect or the provided studies did not test the claims, or reported conflicting results:
Psilocybin, also known as 4-phosphoryloxy-N,N-dimethyltryptamine (4-PO-DMT), is a naturally occurring tryptamine alkaloid and investigational drug found in more than 200 species of mushrooms, with hallucinogenic and serotonergic effects. Effects include euphoria, changes in perception, a distorted sense of time, and perceived spiritual experiences. Psilocin is the metabolite of psilocybin. The compound psilocybin itself is biologically inactive but quickly converted by the body to psilocin. Psilocybin is transformed into psilocin by dephosphorylation mediated via phosphatase enzymes. Psilocin is chemically related to the neurotransmitter serotonin and acts as a non-selective agonist of the serotonin receptors. Activation of one serotonin receptor, the serotonin 5-HT2A receptor, is specifically responsible for the hallucinogenic effects of psilocin and other serotonergic psychedelics. Psilocybin is usually taken orally. By this route, its onset is about 20 to 50 minutes, peak effects occur in about 1 to 2 hours, and its duration is about 4 to 6 hours. Psilocybin mushrooms were used ritualistically in pre-Columbian Mexico, but claims of their widespread ancient use are largely exaggerated and shaped by modern idealization and ideology. In 1958, the Swiss chemist Albert Hofmann isolated psilocybin and psilocin from the mushroom Psilocybe mexicana. His employer, Sandoz, marketed and sold pure psilocybin to physicians and clinicians worldwide for use in psychedelic therapy.
Because of that, the same predictive effect is expected for the HLB index of sucrose ester, although this index has not be built on the basis of an experimental scale, but on the basis of a calculation. By using the same notion of HLB for different categories of surfactants, it is also expected that this tool would be predictive for comparing surfactants belonging to different families, e.g. PEO surfactants and sucrose esters emulsifiers. It is not the case as long as experiments have not brought evidence that correspondences are possible between the scales applied to different surfactants families. Otherwise, it brings confusion. Non-ionic carbohydrate surfactants have a very different chemical structure and different physicochemical properties compared to polyethylene oxide surfactants family. It is the case notably for their emulsifying properties, for their sensitivity to temperature and their interaction with water through hydrogen bonding. Hence, by using the same calculated HLB scale for sucrose fatty acid esters and for polyethylene surfactants, instead of an experimental HLB scale, it is very likely that this scale will not predict properly the properties of sucrose esters. For the same reason, comparison of sucrose esters with non-ionic carbohydrate based surfactants such as Tween series is also uncertain, because the latter are grafted with polyethylene oxide chains that make them behave as PEO surfactants rather than carbohydrate surfactants.
== Further reading == Slater, Anna G.; Cooper, Andrew I. (2015-05-29). "Function-led design of new porous materials". Science. 348 (6238) aaa8075. doi:10.1126/science.aaa8075. PMID 26023142. Satoh, Yusuke; Matsuno, Hirohiko; Yamamato, Takuya; Tajima, Kenji; Isono, Takuya; Satoh, Toshifumi (2017). "Synthesis of Well-Defined Three- and Four-Armed Cage-Shaped Polymers via "Topological Conversion" from Trefoil- and Quatrefoil-Shaped Polymers". Macromolecules. 50 (1): 97–106. Bibcode:2017MaMol..50...97S. doi:10.1021/acs.macromol.6b02316. Mato, Yoshinobu; Honda, Kohei; Tajima, Kenji; Yamamato, Takuya; Isono, Takuya; Satoh, Toshifumi (2019). "A versatile synthetic strategy for macromolecular cages: intramolecular consecutive cyclization of star-shaped polymers". Chemical Science. 10 (2): 440–446. doi:10.1039/C8SC04006K. PMC 6335864. PMID 30746091. Lee, Taeheon; Oh, Joongsuk; Jeong, Jonghwa; Jung, Haeji; Huh, June; Chang, Taihyun; Paik, Hyun-jong (2016-05-24). "Figure-Eight-Shaped and Cage-Shaped Cyclic Polystyrenes". Macromolecules. 49 (10): 3672–3680. Bibcode:2016MaMol..49.3672L. doi:10.1021/acs.macromol.6b00093. ISSN 0024-9297.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
Sources: en.wikipedia.org
Bremelanotide binds several melanocortin receptors, and MC4R is the subtype most often cited as responsible for its behavioural effects. Activity at MC1R, MC3R and MC5R is also reported. Selectivity is therefore described as limited rather than precise.
It is not classified as a vasodilator, and its proposed site of action is the central nervous system rather than peripheral vessels. Some trial participants show small transient blood pressure changes. Whether those changes arise centrally or through another route remains an open question.
Most evidence comes from animal models and from indirect human outcomes such as self-reported desire. Direct measurements of receptor occupancy or signalling in the human brain are not available. Published reviews therefore present a plausible pathway rather than a confirmed sequence of events.
The approved formulation is given by subcutaneous injection and is used on an as-needed basis rather than on a fixed daily schedule. An intranasal version was studied earlier but did not reach the same stage of development. Route of delivery strongly affects how quickly the peptide appears in circulation.